USP48 cloning plasmid

#

• Catalog number
  CSB-CL774808HU2-10ug
• Price:

  Please ask

  Ask for price
• Size
  10ug

# #

• Description
  A cloning plasmid for the USP48 gene.
• Specifications
  Gene name: USP48; Gene ID: 84196; Accession number: BC013567; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 765; Sequence: atgtttacatttgcttccatgaccaaagaagattctaaacttatagctctcatatggcccagtgagtggcaaatgatacaaaagctctttgttgtggatcatgtaattaaaatcacgagaattgaagtgggagatgtaaacccttcagaaacacagtatatttctgagcccaaactctgtccagaatgcagagaaggcttattgtgtcagcagcagagggacctgcgtgaatacactcaagccaccatctatgtccataaagttgtggataataaaaaggtgatgaaggattcggctccggaactgaatgtgagtagttctgaaacagaggaggacaaggaagaagctaaaccagatggagaaaaagatccagattttaatcaaagcaatggtggaacaaagcggcaaaagatatcccatcaaaattatatagcctatcaaaagcaagttattcgccgaagtatgcgacatagaaaagttcgtggtgagaaagcacttctcgtttctgctaatcagacgttaaaagaattgaaaattcagatcatgcatgcattttcagttgctccttttgaccagaatttgtcaattgatggaaagattttaagtgatgactgtgccaccctaggcacccttggcgtcattcctgaatctgtcattttattgaaggctgatgaaccaattgcagattatgctgcaatggatgatgtcatgcaagtttgtatgccagaagaagggtttaaaggtactggtcttcttggacattaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

#

• Gene target
  USP48   cloning  
• Gene symbol
  USP48
• Short name
  USP48 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  USP48 cloning plasmid
• Alternative technique
  plasmids

Gene info

• Identity
  HGNC:18533
• Gene
  USP48
• Long gene name
  ubiquitin specific peptidase 48
• Synonyms gene
  • USP31
• Synonyms gene name
  • ubiquitin specific protease 31
  • ubiquitin specific protease 48
• Synonyms
  • FLJ23277
  • FLJ11328
  • FLJ20103
  • FLJ23054
  • MGC14879
• GenBank acession
  • AF502942
• Locus
  1p36.12
• Discovery year
  2003-05-29
• Entrez gene record
  84196
• Pubmed identfication
  • 12838346
• RefSeq identity
  • NM_032236
• Classification
  • Ubiquitin specific peptidases
• VEGA ID
  OTTHUMG00000007798

Similar products